Efecto de los metabolitos de las raíces de Avena sativa, Medicago sativa, Brachiaria decumbens y Brassica juncea en la degradación de PCBs


PCBs Rhizoremediation assessment using Avena sativa, Medicago sativa, Brachiaria decumbens and Brassica juncea

language DOI 10.17533/udea.acbi.v39n107a01 select_all Tablas multiline_chart Gráficos

Resumen

Este trabajo evaluó el efecto de los compuestos liberados durante la renovación de raíces de cuatro plantas: Avena sativa, Brachiaria decumbens, Brassica juncea y Medicago sativa, en la degradación de seis congéneres de bifenilos policlorados (PCBs) en un suelo contaminado con Aroclor 1260. Los ensayos se realizaron en microcosmos con 20 g de suelo a los cuales se les adicionaron triturados de raíces de las plantas cultivadas en suelo contaminado con PCBs y se usaron como controles: suelo con bifenil y con ácido salicílico y suelo sin adiciones. Los microcosmos se incubaron durante 45 días en condiciones controladas. Al finalizar la incubación se tomaron muestras para la determinación de la concentración de los PCB 44, PCB66, PCB118, PCB138, PCB153, PCB180 y PCB170, del gen BphA1 y determinación de la hidrólisis de fluoresceína. También se analizaron los extractos obtenidos de la raíz para identificar metabolitos secundarios. En los microcosmos con Brassica juncea y con bifenil se observó disminución de la concentración de los PCB66, 118 y 138. Así mismo, en estos microcosmos se observó mayor concentración del gen BphA1 y de fluoresceína. Los análisis de los extractos de raíz permitieron identificar diferentes metabolitos secundarios asociados con las plantas, siendo los extractos de la planta Brassica juncea donde se detectó mayor número de metabolitos. Los resultados permitieron comprobar el efecto de los compuestos liberados por las raíces de ciertas plantas sobre las poblaciones microbianas del suelo con capacidad de degradar PCBs.

Palabras Clave: PCB, rizoremediación, fitoremediación, microrganismos del suelo, residuo peligroso

Abstract

This work evaluated the effect of compounds releases during the root turnover of Avena sativa, Medicago sativa, Brachiaria decumbens and Brassica juncea on degradation of 6 Polychlorinated biphenyls congeners, in a soil polluted with Aroclor 1260. The tests were conducted in microcosm with 20 g of soil to which were added crushed roots of plants previously grown in soil contaminated with PCBs. Microcosms with biphenyl, salicylic acid, and without additions were used as controls. Microcosms were incubated for 45 days under controlled conditions. After incubation time, concentration of PCBs 44, PCB66, PCB118, PCB138, PCB153, PCB180 and PCB170 was determined. BphA1 gene concentration and hydrolysis of fluorescein were also evaluated. Root extracts of plants were analyzed in order to identify some secondary metabolites. In the microcosm with Brassica juncea and biphenyl concentration decreasing of PCBs 66, 118, and 138 was observed. The higher concentration of BphA1 gene and fluorescein was also observed in Brassica juncea and biphenyl microcosms. The analysis of root extracts allowed identifying different secondary metabolites associated with the roots plant, especially in Brassica juncea root extracts. The results allowed testing the effect of the compounds released by the roots of certain plants in the soil microbial populations capable of degrading PCBs.

Key words: PCB, rhizoremediation, phytoremediation, soil microorganisms, hazardous waste

INTRODUCCIÓN

Los Bifenilos Policlorados (PCBs) son un grupo de 209 compuestos obtenidos por la cloración catalítica del anillo del bifenil (Vasilyeva y Strijakova 2007). Debido a sus características fisicoquímicas fueron ampliamente utilizados a nivel industrial con diferentes propósitos, entre los cuales se describen su uso como intercambiadores de calor y fluidos dieléctricos en transformadores eléctricos (Erickson y Kaley 2010). Los PCBs se distribuyeron como mezclas de congéneres por diferentes marcas comerciales, siendo Aroclor®, la marca de Monsanto, una de las mezclas más utilizadas (Passatore et al. 2014).

Considerando los efectos adversos para el ambiente y la salud humana, la fabricación de PCBs fue prohibida en 1970; sin embargo, dada su afinidad por la materia orgánica y su resistencia a la degradación, son compuestos persistentes en suelos y sedimentos (Fiedler et al. 2013, Xu et al. 2010). Aunque su fabricación fue prohibida hace más de 40 años (Gomes et al. 2013), en Colombia todavía existen transformadores que contienen aceites con PCBs y en el mundo se ha registrado un gran número de sitios contaminados como resultado del extensivo uso industrial de los PCBs en el pasado (Yi-Fan et al. 2010, Vasilyeva y Strijakova 2007). Actualmente, los PCBs se encuentran en la lista de Compuestos Orgánicos Persistentes (COPs), prioritarios para ser eliminados para el 2025, según el convenio de Estocolmo (Fiedler et al. 2013). Colombia firmó el Convenio de Estocolmo sobre Contaminantes Orgánicos Persistentes (COP), lo que obliga al país a realizar esfuerzos destinados a lograr una gestión ambientalmente adecuada de los desechos y ambientes contaminados con PCBs, a más tardar, en el 2028.

Los métodos tradicionales para el tratamiento de suelos y sedimentos contaminados con PCBs incluyen excavación con posterior incineración del suelo, extracción con solventes y desorción térmica; estos métodos son altamente costosos y generan un impacto ambiental negativo (Slater et al. 2011), por lo que no pueden utilizarse a gran escala para recuperar los grandes volúmenes de suelos contaminados con PCBs que se calcula hay en la actualidad (Narasimhan et al. 2003). La rizoremediación, un tipo de fitoremediación, utiliza la capacidad que tienen ciertas plantas para promover el crecimiento y la actividad de bacterias degradadoras de compuestos orgánicos contaminantes (Uhlik et al. 2013). Para el caso de los PCBs se han registrado varias especies de plantas que favorecen la disminución de la concentración de PCBs en su rizósfera por diferentes mecanismos como son el cometabolismo, el incremento de la biodisponibilidad de los PCBs y de la aireación del suelo (Van Aken et al. 2010). Otro mecanismo importante que se ha registrado es la liberación de metabolitos secundarios por las plantas (Leigh et al. 2006) durante el crecimiento de sus raíces, los cuales pueden ser usados por los microorganismos como fuente de energía o como inductores de la vía catabólica del bifenil (Singer et al. 2004), vía metabólica usada por los microorganismos aerobios para la degradación de PCBs. La identificación de especies que promueven la degradación de PCBs por microorganismos rizósfericos es esencial para desarrollar un proceso de rizoremediación exitoso.

Aunque hay varias investigaciones que registran el aumento en la degradación microbiana de PCBs por el efecto de los metabolitos exudados por las raíces de diferentes especies de plantas (Passatore et al. 2014), aun no se tiene mucha información de los compuestos presentes en los exudados responsables de este efecto. La mayoría de los estudios se ha realizado en laboratorio, mediante medios de cultivo controlados (Toussaint el. 2012, Pham et al. 2012). Dado que la composición de los exudados puede verse afectada por el tipo de suelo y por el tipo de PCBs, es necesario evaluar el efecto de los metabolitos liberados por las plantas sobre las poblaciones microbianas para determinar su utilidad y optimizar los procesos de rizoremediación. El objetivo de este estudio fue evaluar el efecto de los compuestos liberados por las raíces de Avena sativa (avena), Brachiaria decumbens, Brassica juncea (mostaza) y Medicago sativa (alfalfa) en la degradación de PCBs por microorganismos en el suelo.

MATERIALES Y MÉTODOS

Suelo. El suelo fue obtenido de un vivero y fue contaminado artificialmente con 600 ml de aceite de transformador con Aroclor® 1260, el cual fue agregado en porciones de 50 ml agitando cada vez para asegurar la distribución homogénea de los PCBs. El suelo contaminado fue guardado por seis meses para su estabilización y posterior uso. Antes de iniciar los ensayos se realizaron análisis fisicoquímicos del suelo mediante métodos estándar (IGAC 2006) y se clasificó como franco arcillo arenoso; la concentración de nitrógeno total fue 1,9 mg/kg, la de fósforo 134 mg/kg y el pH 7.1. La concentración de los congéneres de PCBs analizados se muestra en la tabla 1.

Tabla 1. Congéneres de PCB utilizados y su concentración.
Congéneres de PCB Concentración mg/kg
44 (2,2',3,5'-Tetraclorobifenil) 0,53 mg/kg
66 (2,3',4,4'-Tetraclorobifenil) 1,1 mg/kg
118 (2,3',4,4',5-Pentaclorobifenil) 21,8 mg/kg
138 (2,2',3,4,4',5'-Hexaclorobifenil) 38,7 mg/kg
153 (2,4,5,2',4',5'-hexaclorobifenil) 6,2 mg/kg
170 (2,2',3,3',4,4',5-Heptaclorobifenil) 2,4 mg/kg
180 (2,2',3,4,4',5,5'-Heptaclorobifenil) 17 mg/kg

Obtención de raíces. Para este ensayo se utilizaron raíces de Avena sativa (avena), Brachiaria decumbens, Brassica juncea (mostaza) y Medicago sativa (alfalfa), las cuales fueron cultivadas previamente durante seis meses en suelo contaminado con Aroclor® 1260. Las raíces fueron separadas del resto de la planta y se lavaron con agua destilada para remover el exceso de suelo y posteriormente se conservaron a 4 °C hasta su uso. Para los ensayos en microcosmos se utilizaron las raíces finas (≤ 1 mm de diámetro y 1 a 5 mm de longitud), las cuales fueron cortadas de las raíces más largas, maceradas usando nitrógeno líquido e inmediatamente añadidas al microcosmos (Slater et al. 2011).

Microcosmos. Los microcosmos se llevaron a cabo de manera similar a lo descrito por Slater et al. (2011) con algunas modificaciones. Se utilizaron botellas de vidrio con 20 g de suelo y se agregó 1 g del macerado obtenido de las raíces de cada planta. Como control se utilizó suelo con 5 mg de bifenil disuelto en acetona o 5 mg de ácido salicílico disuelto en agua. También se realizó un control sin adición de raíces ni compuestos. La humedad se mantuvo en 60%. Las botellas se mezclaron por agitación manual y los aglomerados de suelo fueron destruidos con una espátula estéril. Las botellas fueron selladas con tapones de caucho y se introdujo una aguja para permitir el intercambio de gases. Todos los ensayos se realizaron por triplicado. Para el control con bifenil, antes de sellar las botellas, se permitió la evaporación de la acetona. Los microcosmos fueron incubados a 28 °C en oscuridad y se tomaron muestras a los 45 días para determinar la concentración de PCBs, la concentración del gen BphA1 y la actividad enzimática de la fluoresceína.

Cuantificación del gen BphA1. Para determinar la concentración del gen BphA1, el ADN fue extraído del suelo usando el kit Powersoil® (Mo Bio, CA, USA) de acuerdo con las instrucciones del fabricante. Se usaron los cebadores A13 (5´ATGTTCGGCCAGCACATGACG 3´) y A1r (5´GTCAAGAGCGGCAGCAGGAC 3´) (Li et al. 2013). La reacción de PCR se llevó a cabo en un termociclador LightCycler 1.5 (Roche®, Bogotá, Colombia). El volumen final de reacción fue 20 μl que contenían 10 μl del FastStart SYBR Green Master (Roche®, Bogotá Colombia), 0,5 mM de cada primer y 10 μl de ADN o agua grado PCR como control negativo. El protocolo de amplificación fue: 1 ciclo a 95 °C por 10 min, seguido por 45 ciclos a 95 °C por 30 s, 50 °C por 30 s y 72 °C por 1 min.

Análisis de PCBs en suelo. Los PCBs evaluados fueron PCB44, PCB66, PCB118, PCB138, PCB153, PCB180 y PCB170 (tabla 1) que son los congéneres más representativos del Aroclor® 1260 (US-EPA 2007). La extracción de los PCBs del suelo se realizó de acuerdo con el método 8082A (US-EPA 2007). Para la extracción de PCBs del suelo se tomaron 10 g de suelo previamente seco a temperatura ambiente. La extracción se llevó a cabo con 20 ml de una mezcla de acetona: hexano 1:1 (Merck®, Darmstadt, Alemania), luego se sonicó por 20 min en un baño ultrasónico y se filtró a través de un acrodisco de 0,22 µm de nylon Whatman®. Este proceso se repitió tres veces. El extracto fue secado con nitrógeno hasta 1 ml y se reconstituyó a 5 ml con hexano. Para la limpieza del extracto se utilizó ácido sulfúrico al 50%. El proceso de limpieza se repitió las veces que fue necesario. La cuantificación de los congéneres de PCBs se realizó por cromatografía GC-MS. El procedimiento se realizó en un cromatógrafo modelo 7890A acoplado a un espectrómetro de masas MSD modelo 5975C, con energía de ionización por impacto electrónico de 70eV y un automuestreador 7693 (Agilent®, CA, USA). Se usó una columna capilar HP-5MS UI de 30m de longitud, 0,25mm de diámetro interno y 0,25 µm de espesor de película (Agilent®, CA, USA). Para la adquisición de datos se utilizó el software Chemstation® de la misma casa comercial. Como estándar interno se utilizó el PCB 209. Las condiciones cromatográficas para GC MS utilizadas fueron las siguientes: Gas de arrastre: Helio a 1,5 mL/min, Programa del horno: Comenzó a 40 °C durante 2 min, luego aumentó hasta 150 °C a una rata de 30 °C/min por 1 min, posteriormente aumentó hasta 250 °C a una rata de 3 °C/min, tiempo en el cual permaneció 1 min, se volvió aumentar hasta 310 °C a una rata de 25 °C/min, tiempo en el cual permaneció 10 min. El programa de temperatura también incluyó un post-run de 5 min a 310 °C. Volumen de inyección: 2 µL, Tipo adquisición: SIM/SCAN, Tiempo total corrido: 53,4 minutos. La remoción de PCBs se calculó de la siguiente manera:

Determinación de la actividad enzimática de fluoresceína. Dos gramos de suelo se depositaron en tubos cónicos de 50 ml, se añadieron 15 ml de buffer fosfato pH 7.6 y 200 µl de FDA (Sigma-Aldrich®, St. Louis, USA), se agitaron manualmente y se incubaron a 30 °C a 100 rpm por 20 min. Después del tiempo de incubación se agregaron 15 ml de una solución de cloroformo/metanol (Merck®, Darmstadt, Alemania) y se agitó manualmente; los tubos se centrifugaron a 2000 rpm por 3 min, luego se filtró el sobrenadante con filtros de nylon de 0,45 µm Whatman® y se determinó la absorbancia a 490 nm (Adam y Duncan 2001). La concentración de fluoresceína se determinó a partir de una curva basada en un estándar de fluoresceína (Sigma-Aldrich®, St. Louis, MO, USA).

Obtención de extractos de la raíz. Para la obtención de extractos de raíz, con el fin de identificar metabolitos secundarios, las raíces fueron lavadas con abundante agua destilada hasta remover todas las partículas de suelo, cortadas en pequeños trozos y maceradas en un mortero; posteriormente se agregó agua y se continuó el macerado utilizando un homogenizador. La suspensión fue centrifugada y se conservó el sobrenadante. El proceso de macerado se repitió dos veces con el precipitado. Los extractos de las raíces fueron esterilizados por filtración mediante un filtro de 0,45 μm Whatman® y se conservaron a 4 °C hasta su análisis.

Identificación de metabolitos secundarios en los exudados. Los análisis cromatográficos se llevaron a cabo con un sistema UltiMate 3000 RS UHPLC (Thermo Scientific, MA, USA); la separación de los compuestos se realizó a través de una columna Hypersil GOLD aQ C18 (100 x 2,1 mm, 1,9 µm de tamaño de partícula) del mismo fabricante. La detección de los compuestos se realizó en un espectrómetro de masas de alta resolución Quadrupolo-OrbitrapTM de ThermoScientific Q Exactive. Se empleó una fuente de ionización ESI en modo positivo. Para la adquisición y procesamiento de los datos se empleó el software XcaliburTM 2.2 con el programa Qual Browser (Thermo Scientific, MA, USA).

Análisis estadístico de los datos. Los datos fueron analizados a través del programa estadístico “R” empleando técnicas de exploración de datos, elaboración de modelos lineales, verificación de supuestos y pruebas de contraste entre medias para determinar diferencias estadísticamente significativas entre los tratamientos. Se analizó la respuesta de degradación de los PCBs en el suelo. Este análisis se realizó a través del modelo de los efectos teniendo en cuenta el efecto del factor PCB y el factor planta sobre la media de degradación de cada contaminante. El análisis se basó en modelos de regresión lineal en los cuales se evaluó el grado de significancia de cada factor de estudio sobre la variable respuesta correspondiente con un nivel de significancia del 5%.

Resultados

Remoción de PCBs. El PCB 44 no fue detectado al finalizar el experimento en ninguno de los tratamientos, incluyendo los controles. Estudios previos han registrado que los PCBs menos clorados se volatilizan rápidamente al ser vertidos en el suelo, por lo que generalmente los PCBs encontrados en el suelo no corresponden a las mezclas comerciales vertidas inicialmente (Vasilyeva y Strijakova 2007). Esto sugiere que la pérdida del PCB 44 pudo estar relacionada con procesos fisicoquímicos y no se debió estrictamente a procesos biológicos.

En la tabla 2 se muestra el porcentaje de remoción de los congéneres. Al comparar los resultados obtenidos con los diferentes microcosmos, solamente en los que contenían raíces de mostaza y en el control con bifenil se observó remoción de únicamente los congéneres 66, 118 y 138. En los otros microcosmos no se observó una variación significativa en la concentración de los congéneres analizados. El metabolismo de los PCBs por microorganismos es afectado por el número de cloros en la molécula; generalmente, los PCBs menos clorados son lo que se degradan fácilmente (Furukawa y Fujihara 2008) lo cual puede explicar por qué solo se observó disminución de la concentración de los congéneres 66, 118 y 138 que son tetra, penta y hexa clorados respectivamente y, dentro de los congéneres analizados, los que tenían menos contenido de cloro. Aunque el PCB 153 también es hexaclorado, no se observó remoción de este congénere en ninguno de los microcosmos. La posición de los cloros en la molécula afecta la actividad de las enzimas de la vía catabólica (Van Aken et al. 2010) posiblemente por un impedimento estérico, lo que podría explicar por qué solamente se observó remoción del PCB hexaclorado 138.

Tabla 2. Degradación de congéneres de PCB en microcosmos con raíces de plantas.
PCB % Degradación Mostaza % Degradación Bifenil
66 65,8 ±4,8 72,6± 8,3
118 51,7±2,6 64,7±3,1
138 31,8±1,4 49,1±7,2

El bifenil es el sustrato natural de la vía catabólica usada por los microorganismos para la degradación de PCBs (Furukawa y Fujihara 2008). Esto hace necesario utilizar moléculas que activen la vía catabólica para lograr la degradación de PCBs. El balance energético obtenido durante el metabolismo de los PCBs es negativo (Borja et al. 2005), lo cual se traduce en bajas tasas de degradación. Se ha demostrado en ensayos de resting cell con microorganismos degradadores de PCBs, que el bifenil puede activar la vía catabólica aumentando la degradación de PCBs (Toussaint et al. 2012); sin embargo, el uso de este compuesto para la recuperación de suelos no es viable, ya que también se ha demostrado su toxicidad (Slater et al. 2011). Esto hace necesario usar compuestos que activen dicha vía metabólica mediante una activación análoga a la que realiza el bifenil. Los resultados de remoción de PCBs obtenidos con las raíces de mostaza fueron muy similares a los obtenidos con bifenil, lo que sugiere que los compuestos producidos por esta planta tuvieron un efecto similar al del bifenil.

Se calcula que las plantas producen alrededor de 100.000 compuestos naturales de bajo peso molecular conocidos como metabolitos secundarios (Dardanelli et al. 2012). Estos compuestos tienen la capacidad de cambiar la biología de la rizósfera y mejorar la adaptación a un entorno particular (Wenzel 2009). Los metabolitos secundarios pueden ser usados como fuente de carbono y energía por los microorganismos o inducir determinadas vías catabólicas. Los compuestos fenólicos son el grupo más abundante de los metabolitos secundarios de las plantas (Toyama et al. 2009); dentro de este grupo de compuestos, los flavonoides pueden actuar como moléculas inductoras o señalizadoras en los microorganismos para la degradación de diversos compuestos, incluidos los PCBs (Ficko et al. 2011). Esta inducción depende del tipo de compuesto y se ha observado que algunos flavonoides pueden ser más eficientes que otros en la inducción (Toussaint et al. 2012). El efecto inductor de los flavonoides, sobre la degradación de PCBs por microorganismos en el suelo, se ha relacionado con similitud en la estructura, ya que muchos poseen anillos aromáticos, lo cual hace que estos compuestos se comporten como moléculas análogas del bifenil y activen la vía catabólica (Pham et al. 2012). El proceso de muerte y renovación de las raíces es una fuente importante de flavonoides y se ha propuesto como uno de los mecanismos principales para la inducción de las vías catabólicas encargadas de la degradación de PCBs (Leigh et al. 2002, Slater et al. 2011), por esta razón, en este estudio, se seleccionaron las raíces más pequeñas, ya que son las que están relacionadas con el proceso de renovación radicular.

La composición de los productos de las raíces varía considerablemente con la planta y las condiciones ambientales, por lo que la inducción no siempre ocurre de la misma manera. En los microcosmos con avena, alfalfa, Brachiaria, ácido salicílico y el control sin adición de raíces ni compuestos, no se observó disminución en la concentración de ninguno de los congéneres. Estos resultados sugieren que los compuestos presentes en las raíces de avena, alfalfa y Brachiaria no actuaron como inductores, sin embargo, estas plantas han sido reportadas como fitoremediadoras de PCBs (Pereira et al. 2006), especialmente la alfalfa, por lo que no se puede descartar que, bajo las condiciones del estudio, la composición de los exudados de estas plantas no fue la adecuada para actuar como inductores de la degradación y no se puede afirmar que estas plantas no puedan ser usadas para la rizoremediación de PCBs. También se debe tener en cuenta que la fitoremediación ocurre mediante diferentes mecanismos y que, posiblemente, en los estudios donde se han usado estas plantas hayan influido factores como la adsorción y absorción (Van Aken et al. 2010) que no fueron evaluados en este estudio. La adsorción de los PCBs a las raíces se puede descartar como mecanismo de remoción en los microcosmos con mostaza ya que la remoción solo se observó en ese microcosmos con raíces y los PCBs con mayor número de cloros, que son los que generalmente tienen mayor afinidad por la materia orgánica, no mostraron disminución en la concentración.

Los resultados sugieren que los metabolitos liberados por las raíces de mostaza bajo las condiciones del estudio, fueron buenos inductores de los microorganismos del suelo, lo cual puede estar relacionado con el tipo de compuestos liberados por las raíces de la mostaza; sin embargo, la desorción de contaminantes es un proceso que también es influenciado por los exudados de las plantas (Yanzheng et al. 2010). Los PCBs, tienen alta afinidad por la materia orgánica, por lo que la desorción es un mecanismo que aumentaría su biodisponibilidad hacia los microorganismos, aumentando su biodegradación. En este estudio no se evaluó la desorción de los PCBs en presencia de las raíces, por lo que no se puede descartar como un mecanismo relacionado con el aumento en la remoción de los congéneres de PCBs.

Cuantificación del gen BphA1 y actividad enzimática de fluoresceína. El gen BphA1 codifica para la subunidad larga de la bifenil dioxigenasa, primera enzima de la vía catabólica del bifenil, por lo que es un buen marcador para estimar la población bacteriana con capacidad de degradar PCBs en suelo (Li et al. 2013). En la figura 1 se muestran los resultados de la concentración del gen BphA1. Las mayores concentraciones de este gen se encontraron en los microcosmos con mostaza y bifenil que igualmente fueron los tratamientos donde se observó la remoción de tres congéneres. El bifenil es el sustrato natural del operon bph, por lo cual era de esperarse que la mayor concentración del gen BphA1 estuviera en el microcosmos con bifenil. El aumento de la concentración del gen en el microcosmos con mostaza sugiere que los metabolitos provenientes de las raíces pudieron sustituir al bifenil como inductores de la vía catabólica.

Figura 1. Concentración del gen BphA1 en los microcosmos.

La hidrólisis de diacetato de fluoresceína es un método rápido para determinar la actividad microbiana en muestras de suelo (Adam y Ducan 2001). Los resultados de la concentración de fluoresceína se muestran en la figura 2. Las mayores concentraciones se encontraron en los microcosmos con raíces de mostaza y bifenil, lo cual se puede relacionar con un mayor metabolismo microbiano asociado con los compuestos liberados por las raíces y el bifenil.

Figura 2.Hidrólisis de Fluoresceína en los microcosmos.

Identificación de metabolitos secundarios en los extractos de raíz. En la figura 3 se muestran los cromatogramas y espectros de masas de los metabolitos secundarios identificados en la raíz. En los extractos obtenidos de las raíces de alfalfa se identificó el compuesto 7-hidroxiflavanona. En los extractos de avena y Brachiaria decumbens se detectó 6-hidroxiflavona. En mostaza se detectó flavanona, flavona e isoflavona.

Figura 3.Cromatogramas y espectros de masas de los metabolitos secundarios identificados en los extractos de raíces. A. Brachiaria decumbensB. Brassica junceaC. Medicago sativa.

En los microcosmos con raíces de mostaza junto con el control con bifenil fue donde se observó la remoción de tres congéneres de PCBs y fue en los extractos de las raíces de mostaza donde se detectó mayor número de metabolitos. Toussaint et al. (2012) registraron la identificación de flavanona como uno de los mayores constituyentes de los exudados de Arabidopsis thaliana y su capacidad para inducir la vía catabólica del bifenil en Rhodococcus erythropolis. Los fenil propanoides como las flavonas e isoflavonas pueden actuar como compuestos análogos del bifenil debido a los anillos aromáticos en su estructura, lo que podría explicar por qué en los microcosmos con mostaza se observó remoción de tres congéneres de PCBs y en los otros no, ya que al haber mayor cantidad de compuestos estos pudieron inducir la vía catabólica de una manera más eficiente.

CONCLUSIONES

Los compuestos liberados por los triturados de raíz de mostaza favorecieron la degradación de tres congéneres en suelo, con porcentajes de degradación muy similares a los obtenidos con el bifenil, que es el inductor natural, lo cual demuestra que en los exudados producidos por las plantas hay compuestos que pueden actuar como inductores de la vía catabólica del bifenil y, por lo tanto, ser reguladores de la actividad enzimática relacionada con la degradación de PCBs en los microrganismos del suelo. Esta relación entre exudados y degradación microbiana puede ser utilizada para mejorar los procesos de rizoremediación.

AGRADECIMIENTOS

La identificación de metabolitos secundarios en los extractos de las raíces demostró que la mostaza produjo mayor diversidad de metabolitos, y a su vez, con esta planta se obtuvo mayor porcentaje de remoción de PCBs, lo que indica que la composición de los exudados afecta el metabolismo de los microorganismos rizosféricos, siendo más eficientes las plantas que producen compuestos con estructuras análogas a los PCBs.

REFERENCIAS

  • Adam G, Duncan H. 2001. Development of a sensitive and rapid method for the measurement of total microbial activity using fluorescein diacetate (FDA) in a range of soils. Soil Biology and Biochemistry, 33 (7-8): 943-951. arrow_upward
  • Borja J, Taleon DM, Auresenia J, Gallardo S. 2005. Polychlorinated Biphenyls and their Biodegradation. Process Biochemistry, 40 (6): 1999-2013. arrow_upward
  • Dardanelli M, Córdoba F, Estévez J, Contreras R, Cubo M, Carvajal MA, Serrano A, López F, Bellogín R, Manyani H, Ollero FJ, Megías M. 2012. Changes in flavonoids secreted by Phaseolus vulgaris roots in the presence of salt and the plant growth promoting rhizobacterium Chryseobacterium balustinum. Applied Soil Ecology, 57: 31–35.
  • Erickson M, Kaley R. 2010. Applications of polychlorinated biphenyls. Environmental Science and Pollution Research, 18 (2): 135-151.